Comment by Raq on Loops in data using str_replace_all and strsplit in R
In this case is a vector but I extract of my dataframe. I edit my question
View ArticleComment by Raq on Loops in data using str_replace_all and strsplit in R
No, the column is tactagcaatacgcttgcgttcggtggttaagtatgtataatgcgcgggcttgtcg
View ArticleComment by Raq on NAs introduced by coercionNAs introduced by coercionError...
Thanks you for your answer but when I change the value of numeric I get: Prom → 1 No Prom → 2 But I would like get: Prom → 1 No Prom → 0
View ArticleComment by Raq on Loops for process to unificate differents excel in R
Thanks for your answer @DPH When I execute the code I return this error: ``` Error: Problem with filter() input ..1. x Input ..1 must be of size 7920 or 1, not size 8928. i Input ..1 is data. Run...
View ArticleComment by Raq on Correlation with discrete and categoric variables in R
Thanks for your answer @Sirius. But I execute this code but I get the next error: Error in match.fun(FUN) : argument "FUN" is missing, with no default
View ArticleComment by Raq on Create a function to filter two columns in R
I need 16 iterations in combination of place and year, any ideas?? Thanks you
View ArticleComment by Raq on How make a COUNT in function of PostgreSQL?
@LaurenzAlbe thanks for your answer, I tryied to use INTO but I don't get it.
View ArticleComment by Raq on How make a COUNT in function of PostgreSQL?
Thanks, I tried it but I get the next error: operator does not exist: double precision = timestamp without time zone
View ArticleComment by Raq on How can create one function from two functions in PostgreSQL?
Thanks for your feedback, I edited my post.
View ArticleComment by Raq on How can create one function from two functions in PostgreSQL?
It's perfect, but I want the function c without parameters. How can I get it?
View ArticleExtracting coordinates from a string in Python
I have this column in my DataFrame df['Y']0 -37.025.7531 -37.024.6212 -37.056.739 ... 214 -3.702.631215 -37.025.369Name: Longitud, Length: 216, dtype: object1.I tried this: df['Y'] =...
View ArticleUsing loops in dataframe with row
I am managing a dataframe with bike data (parking number, street, latitude and longitude, anchors, etc). My goal is to create a function that, on the one hand, through an input, asks the user on the...
View ArticlePlot KMeans Model
I want to plot the centroids of KMeans ML but i dont get it. Add the picture of the graphic.from sklearn.cluster import KMeansfrom sklearn import metricsfrom sklearn.model_selection import...
View ArticleClik here to view.
Scatterplot plot multiple groups of points with different colors
I want to paint different color the key of diccionary, how can i get this?colors: {"Hardcover": "red", "Kindle Edition":"green", "Paperback":"blue", "ebook":"purple", "Unknown Binding":"black", "Boxed...
View ArticleScrapy using loops in Python
I want an activity to scrapy a web page. The part of data web is route_data.route_data = ["javascript:mostrarFotografiaHemiciclo( '/wc/htdocs/web/img/diputados/peq/215_14.jpg', '/wc/htdocs/web', 'Batet...
View ArticleCreate function with parameters in R
I create a function with parameters.arma_function<-function(y,param){ param<-c("c","phi","theta") as.numeric(factor(param)) T<-seq(1:length(y)) mu[1]<-param[["c"]]/(1-param[["theta"]])...
View ArticleCreate a categorical variable
I want to categorized one variable with the next conditionals:0 - 4: "fail"5 - 7: "good"8 - 10: "excellent"None of the above: NAI tried using the recode functionThe values of variable is numericsegur...
View ArticleNAs introduced by coercionNAs introduced by coercionError in knn
When I execute this code, I get the next wrong about coercionNAs:data_test_pred <- knn(train = data_train, test = data_test, cl = data_train_labels, k = 9)NAs introduced by coercionNAs introduced by...
View ArticleLoops for process to unificate differents excel in R
I want to repeat this process with differents Excel files, I would like to make a loops for this but I dont know where I can begin.# Route in excel path <- "mar_2016.xls"# Unificate data for...
View Article
